Informations

Pourquoi certaines injections humaines sont-elles intrapéritonéales ?


Chez l'homme, quel est le bénéfice des injections intrapéritonéales (IP) (vaccins antirabiques anciens/bon marché ou injections liées au cancer) par rapport aux injections intramusculaires traditionnelles ?

Par exemple, là où je vis, la rage n'est pas administrée immédiatement après une morsure en raison de l'inconfort associé (injections IP bon marché) ou du coût (injections intramusculaires plus récentes) qu'elles représentent par rapport à la faible probabilité qu'un chien ait la rage et à la longue période d'incubation. (au lieu de cela, le chien incriminé est observé attentivement pendant 10 jours pour décider, ou les vaccins sont administrés le quatrième jour s'il n'est pas trouvé). Alors, puisque la vitesse d'action ne semble pas être un facteur important, quels sont les avantages des injections IP ?


Les injections IP sont utilisées pour diverses raisons :

  1. Le péritoine offre une grande surface d'absorption du médicament (par rapport à l'administration intramusculaire (IM) ou sous-cutanée) ; peut ainsi injecter un volume de fluide plus important.

  2. Plus facile à injecter que par voie intraveineuse.

  3. Pour certaines chimiothérapies, comme le cancer de l'ovaire, l'injection IP est utilisée pour tenter de localiser le médicament près de la tumeur (c'est à travers un cathéter, plutôt qu'avec une seringue et une aiguille). Essentiellement, l'objectif est de fournir une chimiothérapie à la région abdominale où le cancer s'est propagé plutôt que de manière systémique.

Elle est couramment pratiquée chez les animaux, comme les souris, car il est difficile de trouver une veine chez les petites créatures.

  • https://en.wikipedia.org/wiki/Intraperitoneal_injection
  • http://www.cancer.org/cancer/ovariancancer/detailedguide/ovarian-cancer-treating-chemotherapy
  • http://www.ncbi.nlm.nih.gov/pubmed/20156151 avec l'aimable autorisation de @AMR
  • http://cpharm.vetmed.vt.edu/VM8314/Administration.htm

Qu'est-ce qui rend les injections difficiles à avaler ?

Une évaluation anthropologique des différences entre les pilules et les injections peut éclairer les réticences à la vaccination.

Si vous regardez une émission d'information ou lisez un article de magazine sur l'hésitation à la vaccination, vous pourriez trouver votre programme entrecoupé de publicités pour des médicaments sur ordonnance : des publicités séduisantes de personnes joyeuses et énergiques promettant un soulagement de tout, de l'arthrite au cancer à un stade avancé.

La juxtaposition semble complètement illogique : comment certaines personnes ont-elles développé à la fois un rejet de certains médicaments et un enthousiasme sans réserve pour d'autres ?

En tant qu'archéologue, je suis fasciné par la diversité des objets que nos ancêtres ont inventés au cours de millions d'années, y compris ceux que les gens ont utilisés pour introduire des substances dans leur corps. Cela comprend l'équipement culinaire associé à la production alimentaire et les contenants et accessoires pour les médicaments, les améliorations, les placebos et les drogues récréatives. Ces objets ont un lien intime avec les perceptions humaines de la santé et de la maladie – une partie essentielle de notre identité et de notre routine quotidienne, englobée par l'interrogation omniprésente : « Comment allez-vous ? »

Mon travail m'a amené à réfléchir sur la relation humaine avec différents mécanismes de délivrance médicale, notamment la pilule et l'injection. Ils diffèrent de tant de manières importantes : notre niveau d'indépendance dans leur prise, notre niveau de confort et, surtout, le but visé par le médicament pour guérir dans le présent pressant ou se protéger contre un avenir lointain.

L 'empressement humain à prendre des pilules, mais la réticence de certains à se faire vacciner, a sûrement beaucoup à voir avec la politique moderne et les facteurs sociaux. Mais il a aussi des racines profondes dans notre passé ancestral.

A ce moment de l'histoire, alors que la planète entreprend un programme de vaccination massif, il semble de plus en plus important de comprendre ces différences et de tirer parti des leçons du passé alors que nous nous dirigeons vers l'avenir.

(RE)PENSER HUMAIN

Recevez nos dernières histoires dans votre boîte de réception tous les vendredis.

L'utilisation de la médecine a une très longue histoire. Archéologiquement, on sait que l'utilisation des plantes médicinales a longtemps précédé le développement des plantes domestiquées. La connaissance de la composition remonte aux toutes premières utilisations de l'écriture, lorsque les recettes de médicaments à la fois ingérés et topiques étaient parmi les premières choses que les scribes capturaient sur de l'argile, du bambou et d'autres surfaces.

Un papyrus égyptien de 3 600 ans, par exemple, fournit « Une recette pour transformer un vieil homme en un jeune ». La formule est assez compliquée, impliquant de grandes quantités de quelque chose appelé hemayet fruit qui est meurtri, séché, tamisé, mélangé à de l'eau, cuit, évaporé et séché à nouveau, puis réhydraté dans l'eau de la rivière, étalé pour sécher au soleil et réduit en poudre.

tzi le voyageur de l'âge du cuivre, dont le corps congelé a été retrouvé dans les Alpes italiennes en 1991, avait dans sa trousse deux morceaux de Piptoporus betulinus, un champignon de support qui a un effet de rinçage contre les parasites intestinaux. (Son autopsie a révélé qu'il souffrait de troubles intestinaux, comme la plupart des gens le faisaient probablement à l'époque.)

Certaines pratiques médicales de guérison remontent à des milliers d'années. DEA Picture Library/De Agostini/Getty Images

Bien que la pratique consistant à manger des substances médicinales existe probablement depuis des millions d'années (même les primates non humains s'auto-soignent), les injections sont relativement nouvelles. Les projectiles tels que les lances et les balles ont une longue histoire de perçage de la peau, mais à des fins de mal.

Même après que les gens aient développé des techniques invasives pour aider plutôt que blesser, y compris l'acupuncture, l'amputation et la trépanation, il y avait encore peu d'expérience de l'utilisation de la violence pour insérer un composé dans le corps d'une personne dans le but contre-intuitif d'améliorer sa santé. Le tatouage en est un exemple : il existe des preuves que des pratiques de tatouage autochtones millénaires ont été faites en partie pour introduire des composés thérapeutiques. L'idée de vacciner quelqu'un avec des traces d'une maladie pour le protéger semble remonter à avant les années 1500 dans l'Empire ottoman. En Europe, le premier vaccin contre la variole a été développé en 1796. La première seringue hypodermique ne date que des années 1850.

La peur des aiguilles peut être aussi vieille que les aiguilles elles-mêmes et reste un problème même pour ceux qui nécessitent des injections auto-administrées régulières pour leur santé, comme les personnes atteintes de diabète.

De même, notre longue histoire médicinale s'est principalement concentrée sur les maux d'ici et maintenant. Bien qu'il existe une histoire relativement longue de la médecine préventive remontant à des milliers d'années (par exemple, en Chine, en Inde et dans la Grèce antique), nos ancêtres étaient sûrement plus préoccupés par les maladies et les blessures du moment que par le bien-être futur. Les gens bien dans le 19ème siècle ont fait face à la mort et au danger perpétuels comme de vrais loups à la porte. Il y avait déjà beaucoup de douleur et d'inconfort, l'idée d'ajouter plus de douleur dans le présent à un individu en bonne santé afin de prévenir une éventuelle catastrophe future aurait sûrement eu peu de sens.

Un vaccin, contre-intuitivement, est pris lorsque vous allez bien. Vous acceptez une douleur physique (un pincement dans le bras suivi d'effets secondaires qui peuvent aller de légers à sévères) contre un gain futur inconnu (une grande probabilité statistique de protection contre une maladie mortelle). Ce compromis signifie que les vaccins rejoignent d'autres choses qui sont bonnes pour nous que nous n'apprécions pas et que nous ne faisons souvent pas, comme la soie dentaire ou l'épargne pour la retraite.

Un vaccin, contre-intuitivement, est pris lorsque vous allez bien.

En effet, les défis d'imaginer les avantages futurs peuvent être une partie essentielle de l'histoire humaine. Les appréhensions cognitives humaines entourant les activités de paiement immédiat/jeu plus tard sont au cœur de bon nombre de nos énigmes contemporaines concernant la santé, l'économie, l'éducation et le changement climatique.

Une dernière distinction importante parmi les applications médicales est la notion d'autonomie. Qu'il s'agisse d'avaler un comprimé, de boire une potion ou de se mettre un patch sur le bras, l'approche du bricolage semble être populaire : des études hospitalières montrent que les patients préfèrent être en charge de leur propre médicament.

En revanche, les injections vous sont généralement administrées par un « autre » professionnel qui dispose d'un équipement et d'une formation spéciaux. Il est à noter que lorsqu'il s'agit de contraception hormonale féminine, les pilules sont plus populaires que les injections, même si ces dernières durent plus longtemps et pourraient permettre aux gens d'éviter d'avoir à se souvenir d'une pilule quotidienne.

Les pilules sont peut-être la manifestation moderne ultime de la pratique de l'auto-traitement. Lorsque vous prenez une pilule, vous pouvez ressentir les effets de son ingestion et pouvez souvent mesurer l'impact en quelques heures ou moins. Même si les effets sont à long terme ou imperceptibles, l'impact psychologique de la prise d'une pilule (même s'il s'agit d'un placebo) est important. Les fabricants de médicaments ont appris à exploiter tout ce qui concerne les pilules, y compris leur forme, leur taille et leur couleur, pour produire l'effet maximal souhaité. Les annonceurs savent ce qu'ils font : ils font sentir aux gens qu'en prenant des médicaments spécifiques, ils seront comme les gens dynamiques qu'ils ont vus à la télévision.

L'avènement de ce qu'on appelle la médecine « moderne » n'a sans doute été expérimenté qu'au cours des six dernières générations humaines. Il n'est pas surprenant que notre espèce soit encore en train d'accepter des récits de santé qui impliquent des technologies préventives fournies par des moyens invasifs.

Mais et si les vaccins et autres injections étaient repensés afin de rendre le processus plus proche de la prise de pilules ?

Le goût, les visuels et les mécanismes d'administration reformulés pourraient être des éléments clés à explorer pour rendre le traitement médicamenteux plus acceptable pour la psychologie humaine profondément enracinée. Les petites choses peuvent faire la différence. L'encouragement visuel des vaccins, par exemple, est subtilement codé dans la refonte récemment annoncée par Apple de l'emoji de la seringue pour éliminer les gouttes de sang potentiellement intimidantes qui faisaient partie de l'image.

Certains vaccins sont passés des injections aux pilules, comme ce médicament antityphoïdique. K/Wikimedia Commons

D'autres s'efforcent de transférer, lorsque cela est possible, les médicaments injectés vers d'autres systèmes de distribution, en partie pour les rendre plus acceptables. Le vaccin contre la typhoïde est maintenant largement disponible sous forme de pilule, le vaccin contre la grippe saisonnière peut être administré sous forme de spray nasal. Les chercheurs ont développé des patchs d'auto-vaccination qui ont des micro-aiguilles trop petites pour penser qu'une enquête a suggéré que le nombre de personnes disposées à se faire vacciner contre la grippe saisonnière est passé de 46% à 65% avec cette technologie. Des chercheurs, dont Emrullah Korkmaz, bio-ingénieur de l'Université de Pittsburgh, explorent déjà cette possibilité pour les vaccins COVID-19 également.

Nul doute que les futurs traitements médicaux continueront de répondre à notre désir d'autonomie en médecine préventive et curative, tout comme nous chérissons l'autodétermination dans d'autres activités physiques telles que l'exercice, la nutrition et le sexe. Avec un peu plus de réflexion anthropologique, on pourrait bien voir un temps où les injections font partie de l'archéologie de la médecine, avec des aiguilles consignées dans la poubelle de l'histoire.


Modèles pour étudier la régénération du foie

Michele T. Pritchard, Udayan Apte, dans Régénération du foie, 2015

2.2.2.1.1 d -Galactosamine : réponse régénérative hépatique

Des doses non létales de GalN doivent être utilisées pour étudier la régénération du foie. Alors qu'une étude a démontré l'absence de létalité jusqu'à 1 g/kg de GalN chez le rat, d'autres études utilisent beaucoup moins de GalN dans la plage de 200 à 400 mg/kg en doses uniques ou en doses multiples jusqu'à 1 g/kg ou plus pour explorer la régénération du foie. réponse. À ces doses, les lésions hépatiques, évaluées par des mesures histologiques et biochimiques, augmentent 24 h après l'exposition au GalN. Les cellules nécrotiques sont dispersées dans tout le parenchyme mais plus fréquentes dans la zone péricentrale [ 20 ]. Les indications de prolifération des cellules hépatiques commencent à 48 h mais s'étendent de 72 à 96 h après GalN. La prolifération des hépatocytes contribue à la régénération du foie après GalN, mais la contribution de l'HPC (c'est-à-dire les cellules ovales) ne peut être ignorée, en particulier lorsque des doses plus élevées ou des doses multiples [24] de GalN sont utilisées. Les études de marquage des hépatocytes LacZ ont révélé que la prolifération des hépatocytes se produit dès 24 h après l'exposition au GalN. Cependant, dans les études de GalN à haute dose, les nombres de HPC augmentent de 48 à 96 h après 750 mg/kg de GalN et semblent jouer un rôle prédominant dans la régénération du foie [ 24 ].

Il est intéressant de noter que les hépatocytes en prolifération active, tels que ceux trouvés chez les rats nouveau-nés (âgés de 5 jours), sont réfractaires à la mort des hépatocytes médiée par GalN alors que les rats adultes (âgés de 5 mois) ne le sont pas [ 25 ]. Après injection intrapéritonéale de 400 mg/kg de GalN, les rats adultes ont présenté une déplétion des nucléotides d'uracile et du glycogène. Un pic plasmatique d'alanine et d'aspartate aminotransférase (ALAT et ASAT) est observé 24 h après l'exposition à GalN et à 48 h, la réponse régénérative du foie (mesurée par l'incorporation de 3H-thymidine) culmine 48 h après GalN et est réduite par la suite. En revanche, les rats nouveau-nés sont protégés des perturbations métaboliques et hépatotoxiques de l'exposition au GalN [ 25 ]. Ainsi, bien que cette étude démontre certainement que la régénération hépatique médiée par les hépatocytes est possible chez les rats adultes, un effet bénéfique de la prolifération continue des hépatocytes est clairement un avantage pour le résultat de l'exposition aux hépatotoxines. Des résultats similaires concernant l'effet hépatoprotecteur de la prolifération des hépatocytes à l'exposition ultérieure à la toxine sont observés dans des modèles supplémentaires de lésions hépatiques toxiques [26-29].


Mécanisme d'action de la toxine botulique

On disait que le mécanisme d'action de la toxine botulique n'affectait que les nerfs moteurs. Pourtant, les injections de Botox sont également utilisées avec succès pour traiter les douleurs neuropathiques. D'autres recherches montrent que cette toxine inhibe également la libération de neurotransmetteurs dans les nerfs sensoriels.

Une autre découverte récente est que le Botox peut traverser la barrière hémato-encéphalique, bien qu'en petites quantités. Une petite étude sur des femmes ayant reçu des doses non réglementées de Botox provenant de cliniques cosmétiques non enregistrées a montré que cette toxine peut accéder au système limbique du cerveau.

Pour comprendre le mécanisme d'action de la BoNT, nous devons d'abord examiner le neurotransmetteur acétylcholine et la synapse nerveuse.

Acétylcholine

L'acétylcholine (ACh) est le principal neurotransmetteur du système nerveux parasympathique (autonome) et des nerfs moteurs (somatiques) qui se connectent au muscle squelettique. On le trouve également dans certains nerfs sympathiques, ce qui nous fait produire de la sueur et sécréter de l'adrénaline, et certains interneurones du système nerveux central, y compris le système limbique.

Premièrement, l'acétylcholine doit être produite. Il est synthétisé à partir de choline et d'acétyl-CoA et nécessite des ions calcium et une enzyme appelée choline acétyltransférase (CAT) pour convertir ces deux ingrédients en ACh. La majeure partie du produit final est stockée dans des vésicules à la terminaison nerveuse.

Synapse nerveuse

Pour passer d'un nerf à l'autre, ou d'un nerf à une autre cellule (comme une fibre musculaire ou une cellule de glande sudoripare), l'ACh doit traverser une brèche - la synapse. Lorsque l'acétylcholine est le messager chimique agissant, cette synapse est appelée synapse cholinergique.

Les vésicules contenant de l'ACh doivent se déplacer vers la membrane externe de la terminaison nerveuse. Une fois là, ils fusionnent avec la membrane et vident leur contenu dans l'espace (la synapse cholinergique). L'acétylcholine se déplace à travers cet espace et arrive du côté opposé où elle peut stimuler une réponse de la cellule suivante.

Pour libérer l'ACh, une cellule nerveuse a besoin d'ions calcium et d'une chaîne spéciale de protéines de transport appelée complexe SNARE. Le complexe SNARE aide la vésicule à fusionner avec la membrane. C'est à ce stade que tous les types de toxine botulique interfèrent.

De l'autre côté de la synapse se trouve la membrane cellulaire cible. Pour être affectées par l'acétylcholine libérée, ces membranes cellulaires cibles ont besoin de récepteurs ACh.

Il existe deux types de récepteurs : nicotiniques et muscariniques. La plupart des cellules musculaires (sauf cardiaques et certains muscles lisses) possèdent des récepteurs nicotiniques.

Si l'acétylcholine se lie à un récepteur muscarinique, elle excite la cellule cible. Les muscles se contractent et les glandes sudoripares sont stimulées – cet effet est rapide et de courte durée.

Cependant, la liaison de l'ACh à nicotinique récepteurs produit des effets inhibiteurs ou excitateurs à relativement long terme.

Une fois que l'acétylcholine a transmis le message, il est décomposé par une enzyme appelée acétylcholinestérase. Si vous souhaitez un aperçu plus détaillé du mécanisme d'action de l'acétylcholine, consultez cette page.

BoNTs et SNAREs

Si quelqu'un reçoit une injection de toxine botulique, les protéines toxiques se lient aux molécules trouvées seul sur les terminaisons nerveuses cholinergiques et pénètrent dans la cellule.

Une fois là, ils se lient étroitement à une ou plusieurs des protéines du complexe SNARE. Cela empêche (empêche) l'acétylcholine de traverser la synapse cholinergique et d'atteindre la cellule cible.

Dans l'image ci-dessous, vous pouvez voir comment la synaptobrevine se connecte à la vésicule ronde, la guidant vers la membrane terminale. La syntaxine et les protéines SNAP-25 aident les membranes à fusionner et permettent ainsi au contenu de s'échapper du neurone.

La synaptobrevine est une protéine SNARE associée aux vésicules (v-SNARE). Les protéines SNARE associées aux cellules cibles sont la syntaxine et SNAP-25 ce sont les t-SNARE. Tous les trois fournissent l'énergie nécessaire à la fusion membranaire.

La toxine botulique de type A et de type E (BoNT/A et BoNT/E) bloque l'action de SNAP-25. Ces toxines affectent différentes parties de la structure SNAP-25.

Les toxines botuliques de types B, D, F et G affectent l'action de la synaptobrevine à différents points.

BoNT/C agit à la fois sur SNAP-25 et sur la syntaxine.

Une autre différence entre les types de toxine botulique est leur forme. La plupart sont composés de deux chaînes d'acides aminés simples (chaînes di). Seul BoNT/E est une toxine à chaîne unique, il se trouve qu'elle est la plus mortelle - environ cent fois plus toxique que les structures à double chaîne.

Le Botox continuera d'agir jusqu'à trois mois.

Botox contre Black Widow Spider Empoisonnement

Alors que la toxine botulique empêche l'acétylcholine de traverser la synapse, le poison de l'araignée veuve noire a l'effet inverse – ces toxines produisent des effets opposés. Araignée veuve noire plus sérieuse (sp. Latrodectus) les piqûres provoquent une série de symptômes regroupés sous le terme de latrodectisme.

La toxine de l'araignée permet à plus d'ions calcium d'entrer dans la terminaison neuronale, ce qui provoque la circulation de toutes sortes de neurotransmetteurs à travers la synapse. Les symptômes du latrodectisme comprennent une transpiration sévère (excitation des glandes sudoripares), un pouls rapide (excitation des glandes surrénales), une raideur musculaire et une douleur (excitation/contraction des muscles).

Les effets de la toxine botulique sont à l'opposé. L'arrêt de la transmission de l'ACh à la cellule cible signifie l'absence de transpiration (inhibition des glandes sudoripares), un pouls lent (inhibition des glandes surrénales) et un tonus musculaire plus doux (inhibition/relaxation des muscles).


RÉSULTATS

Effet du plasmide pU2 sur les niveaux d'ARNm d'uPA et d'uPAR dans les extraits cellulaires totaux

L'ARN total a été isolé des cellules témoins et des cellules transfectées avec un vecteur vide (EV), un vecteur brouillé (SV), puPAR, puPA et pU2. L'ARN a également été isolé à partir de cellules transfectées avec des vecteurs d'expression antisens pour uPAR et uPA, et à partir de cellules transfectées avec un vecteur plasmidique exprimant la GFP ciblant l'ARNsi. La RT-PCR a été réalisée selon le protocole standard pour uPAR et uPA. Pour déterminer si ces plasmides exprimant l'ARNsi induisent une réponse à l'interféron, une RT-PCR pour OAS1 a été réalisée. En tant que contrôle positif, les cellules ont été traitées avec de l'interféron α (0,5 ng/ml) pour visualiser l'expression de l'ARNm d'OAS1. La figure 2A montre l'analyse RT-PCR de l'ARN total isolé des cellules traitées avec l'interféron α, le contrôle, l'uPAR antisens (asuPAR), l'uPA antisens (asuPA) et les vecteurs exprimant l'ARNsi pour uPAR (puPAR), uPA (puPA) et les deux upAR et uPA (pU2). En tant que contrôles d'ARNi, des siARN ciblant la GFP ont été utilisés dans des cellules non –GFP, un vecteur vide (pEV) et un vecteur brouillé (pSV). La RT-PCR pour GAPDH a servi de contrôle interne. Les cellules traitées à l'interféron n'ont pas montré de changement dans les niveaux d'expression d'uPA ou d'uPAR, l'induction d'OAS1 a été observée et a servi de contrôle pour la RT-PCR d'OAS1. Les cellules témoins, pGFP, pEV et pSV n'ont montré aucun changement dans l'expression d'uPAR ou d'uPA et aucun niveau détectable d'OAS1 n'a été observé. L'antisens pour uPAR et uPA n'a pas montré de changement dans les niveaux d'ARNm d'uPAR ou d'uPA, alors que les niveaux de protéines ont montré une diminution de 20 % (non illustré). Les cellules traitées avec puPAR ont montré une diminution de 20 % de l'expression d'uPA et une diminution de 50 % de l'expression d'uPAR. Les cellules traitées avec puPA n'ont pas montré de changement appréciable dans les niveaux d'expression d'uPAR alors que les niveaux d'uPA ont montré une diminution de 30 0201360 %. Les cellules traitées avec pU2 ont montré une diminution de 75 % des niveaux d'ARNm d'uPAR et une diminution de 60 % des niveaux d'ARNm d'uPA. Les niveaux de GAPDH n'ont pas changé et ont servi de témoins.

L'ARN total a été isolé des cellules témoins et des cellules transfectées avec un vecteur vide (EV), un vecteur brouillé (SV), puPAR, puPA ou pU2. L'ARN a également été isolé à partir de cellules transfectées avec des vecteurs d'expression antisens pour uPAR et uPA, et à partir de cellules transfectées avec un vecteur plasmidique exprimant l'ARNsi pour la GFP. La RT-PCR a été réalisée selon le protocole standard pour uPAR et uPA. Pour déterminer si ces plasmides exprimant l'ARNsi induisent une réponse à l'interféron, une RT-PCR pour OAS1 a été réalisée. En tant que contrôle positif, les cellules ont également été traitées avec de l'interféron alpha (0,5 ng/ml) pour visualiser l'expression de l'ARNm d'OAS1 (figure 2A). Des cellules SNB19 ont été transfectées avec un mock, EV/SV, puPA, puPAR ou pU2. Après 48 h, les cellules ont été collectées et les lysats cellulaires totaux ont été préparés dans un tampon d'extraction contenant du Tris [0,1 M (pH 7,5)], du Triton-X114 (1,0 %), de l'EDTA (10 m&# x0039c), de l'aprotinine et du fluorure de phénylméthylsulfonyle comme décrit précédemment. Par la suite, 20 mg de protéine de ces échantillons ont été séparés dans des conditions non réductrices par 12% de SDS-PAGE et transférés sur des membranes de nitrocellulose (Schleicher & Schuell, Keene, NH). Les membranes ont été sondées pendant 2 h avec des anticorps contre uPAR (figure 2B). Les membranes ont ensuite été lavées trois fois avec du PBS pour éliminer l'excès d'anticorps primaire, incubées avec un anticorps secondaire selon les besoins, puis développées selon le protocole standard. Pour le contrôle de charge, les membranes ont été extraites et sondées avec des anticorps monoclonaux pour GAPDH. L'activité enzymatique et le poids moléculaire des formes séparées par électrophorèse d'uPA ont été déterminés à partir du milieu conditionné de cellules SNB19 transfectées avec des simulations, EV/SV, puPA, puPAR ou pU2 par SDS-PAGE comme décrit précédemment (Fig. 2B). L'analyse par transfert Western a également été réalisée en utilisant des lysats cellulaires de 4910 cellules xénogreffes surexprimant l'EGFR 4910 transfectées avec des simulations, EV/SV, puPA, puPAR ou pU2. Les transferts de Western ont été immunosondés pour l'EGFR et le VEGF selon les protocoles standard (Fig. 2C).

Effet de pU2 sur l'activité enzymatique uPA et uPAR dans les cellules SNB19 et les niveaux de protéines EGFR et VEGF dans 4910 cellules xénogreffes

L'ARNi ciblé contre la dégradation protéolytique pourrait être une intervention importante pour prévenir l'invasion des cellules cancéreuses. Il a été démontré que l'uPA et l'uPAR jouent un rôle important dans la dégradation de la MEC. Comme démontré par western blot, la transfection de cellules SNB19 avec un vecteur exprimant l'ARNsi pour uPAR et uPA (pU2) a fortement inhibé l'expression protéique des niveaux d'uPAR par rapport aux cellules transfectées avec un vecteur fictif et vide (EV)/vecteur brouillé (SV) ( figure 2B). La zymographie de fibrine a révélé que l'activité enzymatique de l'uPA diminuait significativement dans les cellules SNB19 transfectées avec puPAR, puPA et pU2 par rapport à la transfection fictive et EV/SV (figure 2B). Les niveaux de protéine GAPDH ont servi de contrôle de charge (figure 2B). L'analyse quantitative des bandes uPAR et uPA par densitométrie a révélé une diminution significative (Pπ.001) de la protéine uPAR (13 à 16 fois) et de l'activité enzymatique uPA (10 à 12 fois) dans les cellules transfectées par pU2 par rapport aux cellules simulées et transfectées par EV/SV. Les cellules transfectées avec puPAR et puPA ont inhibé les niveaux d'uPAR et d'uPA presque de la même manière que pU2, mais la régulation négative des molécules cibles était beaucoup plus prononcée avec la construction bicistronique par rapport à l'une ou l'autre des constructions simples. 4910 cellules de xénogreffe ont présenté une régulation négative similaire de l'uPA et de l'uPAR en tant que cellules SNB19 (données non présentées). Étant donné que les niveaux d'EGFR sont surexprimés dans 4910 cellules, nous avons déterminé l'effet de la transfection pU2. Une régulation négative simultanée d'uPAR et d'uPA a diminué d'au moins 15 fois les niveaux d'EGFR dans 4910 cellules, tandis que les niveaux de VEGF ont diminué d'un facteur 5 (figure 2C). Les niveaux de GAPDH n'ont pas changé et ont servi de contrôle de charge. In situ les niveaux de VEGF et d'EGFR ont également été déterminés et ces résultats ont été corrélés avec l'analyse par transfert Western (figure 3A).

Pour visualiser l'expression du VEGF et de l'EGFR dans les cellules 4910 surexprimant l'EGFR, 4 cellules ont été ensemencées sur des lames de chambre à 8 puits recouvertes de vitronectine, incubées pendant 24 h et transfectées avec un vecteur vide (EV) et un vecteur exprimant l'ARNsi pour uPAR (puPAR), uPA (puPA) ou les deux (pU2). Après 72 h, les cellules ont été fixées avec du formaldéhyde à 3,7 % et incubées avec de l'albumine de sérum bovin à 1 % dans du PBS à température ambiante pendant 1 h pour le blocage. Après que les lames aient été lavées avec du PBS, soit des IgG anti-VEGF (souris) soit des IgG anti-EGFR (souris) ont été ajoutés à une concentration de 1:200. Les lames ont été incubées à température ambiante pendant 1 h et lavées trois fois avec du PBS pour éliminer l'excès d'anticorps primaire. Les cellules ont ensuite été incubées avec des IgG anti-souris conjuguées FITC (dilution 1:500) pendant 1 h à température ambiante. Les lames ont été lavées trois fois, recouvertes de lamelles de verre avec des supports de montage contenant du DAPI, et des photomicrographies fluorescentes ont été obtenues. La figure 3A montre l'expression d'EGFR et de VEGF dans des cellules 4910 de contrôle et transfectées par EV/SV, puPAR, puPA et pU2. Déterminer in vitro des cellules d'angiogenèse, 4910 ou SNB19 (2x10 4 /puits) ont été ensemencées dans des lames de chambre à 8 puits et transfectées avec un vecteur fictif vide (EV) et un vecteur exprimant l'ARNsi pour uPAR (puPAR), uPA (puPA) ou les deux (pU2 ). Après une période d'incubation de 24 h, le milieu conditionné a été retiré et ajouté à 4 x 104 monocouches de cellules endothéliales dermiques humaines dans des lames de chambre à 8 puits. Les cellules endothéliales dermiques humaines ont pu croître pendant 72 h. Les cellules ont ensuite été fixées dans du formaldéhyde à 3,7 %, bloquées avec de l'albumine de sérum bovin à 2 % et incubées avec un anticorps primaire contre le facteur VIII (DAKO Corp., Carpinteria, CA). Les cellules ont ensuite été lavées avec du PBS et incubées avec un anticorps secondaire conjugué au FITC pendant 1 h. Les lames ont été lavées et la formation de structures de type capillaire a été observée en utilisant la microscopie à fluorescence (Fig. 3B). Les cellules endothéliales ont également été cultivées dans des milieux conditionnés de cellules 4910 ou SNB19 transfectées avec un vecteur fictif vide (EV) et un vecteur exprimant l'ARNsi pour uPAR (puPAR), uPA (puPA) ou les deux (pU2). Les cellules endothéliales ont pu se développer pendant 72 h et H&# x00026E colorées pour la visualisation de la formation du réseau (Fig. 3B). Comme déterminé par in vitro quantification de l'angiogenèse, des résultats similaires ont été obtenus pour les cellules SNB19 et 4910. Le degré d'induction angiogénique a été quantifié pour les cellules SNB19 et 4910 sur la base de la valeur numérique du produit du nombre de branches et du nombre de points de branchement (*p valeur = 0,005) (Fig. 3C). La figure 3D montre in vivo dosage angiogénique utilisant le modèle de pli cutané dorsal tel que décrit dans Méthodes. Brièvement, les animaux ont été implantés avec des chambres de diffusion contenant des cellules 4910 témoins ou transfectées par pU2 dans une cavité dorsale. Dix jours après l'implantation, les animaux ont été sacrifiés et le système vasculaire rincé avec une solution de FITC. Le pli cutané recouvrant la chambre de diffusion a été observé pour la fluorescence FITC et en lumière visible pour la présence de néovascularisation induite par la tumeur (TN) et de vascularisation préexistante (PV).

Inhibition de la formation de réseaux capillaires induits par les cellules tumorales par pU2

Les tumeurs émergentes dépendent de la formation de nouveaux vaisseaux sanguins pour alimenter la croissance tumorale. Comme il a été rapporté que uPA et uPAR régulent l'angiogenèse, nous avons ensuite évalué l'effet de pU2 sur l'angiogenèse induite par les cellules tumorales. Nous avons effectué une analyse immunohistochimique en utilisant l'antigène du facteur VIII pour évaluer la formation de vaisseaux induits par la tumeur dans un in vitro système de co-culture et coloration H&# x00026E de cellules endothéliales cultivées dans des milieux conditionnés de cellules xénogreffes SNB19 et 4910 après transfection avec mock, EV/SV, puPA, puPAR ou pU2. Les résultats ont démontré que les cellules endothéliales formaient des structures de type capillaire en présence de cellules fictives et transfectées par EV/SV dans les 48 h. En revanche, le vecteur pU2 a significativement inhibé la formation de réseau capillaire induite par les cellules tumorales. Les cellules xénogreffes SNB19 et 4910 ont présenté un comportement similaire bien que les cellules xénogreffes 4910 aient été légèrement plus agressives en termes d'angiogenèse par rapport aux cellules SNB19 (figure 3B). La quantification des points de ramification et du nombre de ramifications était extrêmement faible dans les co-cultures transfectées par pU2 par rapport aux cellules fictives et transfectées par EV/SV. Dans le cas des co-cultures de xénogreffes, des structures rudimentaires de type réseau ont été observées dans le groupe de traitement pU2 (Fig. 3B). L'effet était inférieur à 50 % à 60 % dans les co-cultures transfectées par puPA et puPAR, respectivement, par rapport aux co-cultures transfectées simulées et EV/SV par rapport à la formation de structure de type capillaire (figure 3C). Pour confirmer le in vitro expériences de co-culture, nous avons examiné si pU2 pouvait inhiber l'angiogenèse tumorale in vivo tel qu'évalué par le modèle de fenêtre dorsale. L'implantation d'une chambre contenant des cellules de xénogreffe 4910 fictives et vides transfectées par vecteur a entraîné le développement de microvaisseaux avec des structures minces et incurvées et de nombreux minuscules points de saignement [comme indiqué par les flèches (TN = néovascularisation induite par la tumeur PV = système vasculaire préexistant)]. En revanche, l'implantation de 4910 cellules xénogreffes transfectées avec pU2 n'a pas entraîné le développement de microvaisseaux supplémentaires (Fig. 3D). Des résultats similaires ont été obtenus avec des cellules SNB19 (données non présentées).

SiRNA contre uPA et uPAR inhibe la migration et l'invasion des gliomes

Pour déterminer si l'expression de l'ARNsi uPAR et uPA est capable d'influencer la migration des cellules tumorales, nous avons transfecté des sphéroïdes de xénogreffe SNB19 et 4910 avec le puPAR, le puPA et le pU2. Comme le montre la figure 4A, il y avait une migration cellulaire beaucoup plus élevée dans les sphéroïdes de contrôle et transfectés par EV/SV que dans les sphéroïdes transfectés par pU2. Comme démontré par la quantification de la distance de migration hors des sphéroïdes, la migration cellulaire du contrôle et des sphéroïdes transfectés par EV/SV était significativement plus élevée (P&# x0003c0,05) par rapport aux sphéroïdes transfectés par pU2. Une migration cellulaire modérée à partir de sphéroïdes tumoraux transfectés avec puPAR et puPA a été observée. De plus, 4910 cellules xénogreffes semblaient être plus migratrices que les cellules SNB19. L'effet de pU2 était similaire dans les cellules de xénogreffe SNB19 et 4910 (figure 4A).

La migration a été testée comme décrit précédemment. Des sphéroïdes de cellules SNB19 ou 4910 ont été préparés en ensemençant une suspension de 2x10 6 cellules dans du milieu Eagle modifié de Dulbecco sur des plaques de culture tissulaire de 100 mm à attachement ultra faible et cultivés jusqu'à la formation d'agrégats de sphéroïdes. Mesure des sphéroïdes

150 μm de diamètre (environ 4x10 4 cellules/sphéroïde) ont été sélectionnés et transfectés avec un vecteur fictif vide (EV) et un vecteur exprimant l'ARNsi pour uPAR (puPAR), uPA (puPA) ou les deux (pU2). Three days after infection, single glioma spheroids were placed in the center of each well in vitronectin-coated (50 μg/ml) 96-well microplates and 200 μl of serum-free medium was added to each well. Spheroids were incubated at 37ଌ for 24 h, after which the spheroids were fixed and stained with Hema-3 and photographed. Cell migration from spheroids to monolayers was quantified using a microscope calibrated with a stage and ocular micrometer and represented graphically (Fig. 4A). In vitro invasion of SNB19 and 4910 cells was determined by measuring the cells that invaded through matrigel-coated (Collaborative Research, Inc., Boston, MA) transwell inserts (Costar, Cambridge, MA). Briefly, transwell inserts with 8 μm pores were coated with a final concentration of 1 mg/ml of matrigel, SNB19 cells transfected with mock, EV/SV, puPAR, puPA or pU2 were trypsinized, and 200 μl aliquots of cell suspension (1x10 6 cells/ml) were added to the wells in triplicate. After a 24 h incubation period, cells that passed through the filter into the lower wells were quantified as described earlier and expressed as a percentage of cells in the lower wells. Cells on the lower side of the membrane were fixed, stained with Hema-3 and quantified as percent invasion (Fig. 4B). SNB19 and 4910 spheroids were cultured in 6-well ultra low attachment plates. Briefly, 3x10 6 cells were suspended in 10 ml of medium, seeded onto the plates and cultured until spheroids formed. Spheroids, 100� μm in diameter, were selected and transfected with mock, EV/SV, puPAR, puPA or pU2. Three days after infection, tumor spheroids were stained with the fluorescent dye DiI and confronted with fetal rat brain aggregates stained with DiO. The progressive destruction of fetal rat brain aggregates and invasion of SNB19 cells were observed by confocal laser scanning microscopy and photographed as described previously (32, 33). The remaining volume of the rat brain aggregates at 24, 48 and 72 h were quantified using image analysis software as described previously and graphically represented (Fig 4C). X= 4910 xeno

To evaluate the effect of siRNA-mediated inhibition of uPAR and uPA on glioma invasiveness, we utilized a two-model system: the standard matrigel invasion assay and the spheroid invasion assay. SNB19 or 4910 xenograft cells transfected with mock and EV/SV extensively invaded the matrigel-coated transwell insert. In contrast, the pU2-transfected cultures had markedly much less invasiveness through the matrigel as compared to control and EV/SV-transfected cells. Quantitative determination of invasion confirmed that pU2 transfection demonstrated only 6% invasion in SNB19 cells and 8% invasion in 4910 xenograft cells as compared to mock and EV/SV-transfected cells ( Fig. 4B ). Further, quantitative analysis results of invasion of SNB19 and 4910 xenograft cells transfected with puPAR and puPA was 22% (SNB19), 30% (4910) and 35% (SNB19), 40% (4910), respectively ( Fig 4B ).

We further examined the extent of the pU2 effect in a spheroid invasion assay. The EV/SV-transfected spheroids progressively invaded fetal rat brain aggregates and quantitation revealed that the glioma spheroids invaded the fetal rat brain aggregates by 25% within 24 h, 㹰% within 48 h, and 㺐% at 72 h. In contrast, the tumor spheroids transfected with the pU2 vector invaded the fetal rat brain aggregates by only 2% (SNB19) and 2.8% (4910 xeno) after 72 h. Invasion of fetal rat brain aggregates by the single constructs were: 20% (SNB19) and 23% (4910 xeno) with puPAR, and 40% (SNB19) and 60% (4910 xeno) with puPA ( Fig. 4C ). Taken together, these findings provide strong evidence that RNAi-mediated silencing of uPAR and uPA greatly inhibits glioma cell invasion in both in vitro models in comparison to the single siRNA constructs for uPAR and uPA.

UPA and uPAR siRNA suppresses intracranial tumor growth

We used an intracranial tumor model with 4910 xenograft cells to assess the effects of RNAi-mediated inhibition on pre-established tumor growth in vivo. Paraffin brain sections of the untreated (mock) and EV/SV-treated control groups were characterized by large-spread tumor growth after a 5-week follow-up period as visualized by Hɮ staining of similar sections ( Fig. 5A ). However, we could not detect tumors in mice treated with the pU2 vector ( Fig. 5A ). Further quantification of Hɮ-stained brain sections by a neuropathologist (Dr. Gujrati) blinded to treatment condition revealed no difference in tumor size between the control and EV/SV treatment groups. However, total regression of pre-established tumors was revealed in the pU2-treated group ( Fig. 5A & 5B ). Pre-established intracranial tumor growth was inhibited by 70% in puPAR-treated mice and 55% in puPA-treated mice. These results demonstrated that RNAi-mediated suppression of uPAR and uPA inhibited pre-established intracranial tumor growth. Paraffin sections were probed for uPA and uPAR protein as previously described (see Materials and Methods). pU2-treated mice did not exhibit uPAR or uPA protein expression above expected background levels (not shown) whereas the control and EV/SV-treated mice showed increased levels of uPAR and uPA expression localized at the tumor region ( Fig 5C ). To determine whether this downregulation of protein expression was caused by pU2 treatment, paraffin brain sections of 4910 cells implanted in untreated mice (mock) and mice treated with SV/EV, puPAR, puPA and pU2 were probed with an alkaline phosphatase labeled oligo for the CMV promoter region of the pcDNA3 plasmid vector. In the mock sections, no alkaline phosphatase activity was detected. In contrast, we observed alkaline phosphatase activity in the EV/SV-, puPAR-, puPA- and pU2-treated mice, indicating the presence of a pcDNA3 vector in the tissue ( Fig 5D ). As a positive control, mice were injected intracranially with interferon α to determine OAS1 expression. Total RNA from fresh or paraffin-embedded brain sections was used for RT-PCR to determine in vivo induction of interferon response plasmids inducing RNAi (see Materials and Methods). From the RT-PCR analysis, it is clear that no OAS1 induction was observed in the mock, EV/SV-, puPAR-, puPA- or pU2-treated mice. RT-PCR for GAPDH served as an internal control ( Fig 5E ). The presence of a pcDNA3 vector was confirmed by regular PCR analysis ( Fig 5E ). To determine the survival rate of mice implanted with 4910 xenograft intracranial tumors, we performed a long-term survival study, Thirty days after implantation, all of the control mice died and paraffin sections of these brains revealed the presence of large intracranial tumors ( Fig 5A ). In contrast, pU2-treated mice survived much longer. One mouse from the pU2-treated group died after 43 days, but paraffin sections revealed the presence of a hemorrhage and very few xenograft cells indicating that the death of this animal was not due to an intracranial tumor (not shown). The remaining 5 animals in the pU2-treated group were sacrificed after 112 days. Paraffin sections of these mice revealed no intracranial tumors, normal brain morphology, and no visible 4910-xenograft tumor cells. The survival rate is represented as percent survival in Figure 5F .

For the intracerebral tumor model, 2x10 6 4910 xenograft tumor cells were intracerebrally injected into nude mice. Ten days after tumor implantation, the mice were treated with intraperitoneal injections of pU2 (150μg/injection/mouse) every other day three times. Control mice were either injected with PBS alone or with an empty plasmid vector (150μg/injection/mouse). Five weeks after tumor inoculation, six mice from each group were sacrificed via cardiac perfusion with 3.5% formaldehyde in PBS, their brains removed, and paraffin sections prepared. Sections were stained with hematoxylin and eosin to visualize tumor cells and to examine tumor volume as described in Methods (arrows point to approximate site of intracranial implantation site) (Fig. 5A & 5B). To visualize the expression levels of uPAR and uPA in intracranial tumors, mouse brains were fixed in formaldehyde and embedded in paraffin per standard protocols. Sections were deparaffinized, blocked in 1% BSA in PBS for 1 h, and subsequently transferred to primary antibody (uPAR and uPA) diluted in 1% BSA in PBS (1:500). Sections were allowed to incubate in the primary antibody solution for 2 h at 4஬ in a humidified chamber, followed by a wash in 1% BSA in PBS and placed in a solution with the appropriate (anti-mouse and anti-rabbit FITC) secondary antibody. The sections were allowed to incubate with the secondary antibody for 1 h and visualized using a confocal microscope. Images were obtained for FITC. Transmitted light images were also obtained after Hɮ staining to visualize the morphology of the sections. A control study was performed using a normal rabbit immunoglobulin fraction as the primary antibody (control Ab) instead of uPAR or uPA (Fig. 5C). In situ hybridization was performed to determine the presence of transfected plasmid intracranially after intraperitoneal injections. Briefly, ten days after tumor implantation the mice were treated with intraperitoneal injections of control, EV/SV, puPAR, puPA or pU2 (150μg/injection/mouse) every other day three times. Control mice were injected with PBS alone. Five weeks after tumor inoculation, six mice from each group were sacrificed and brains processed as described in Methods. Sections were deparaffinized and probed for pcDNA3-CMV promoter using specific alkaline phosphatase-labeled DNA oligo (CTGGTGTCGACCTGCTTCCGCGATGTACGGGC) per standard protocols. The presence of CMV promoter was determined by the development of a blue precipitate of NBT alkaline phosphatase substrate. Arrows point to region of localization (Fig. 5D). The presence of plasmids intracranially was also determined by PCR amplification of CMV to BGH construct region of the plasmid using deparaffinized intracranial sections of control, EV/SV-, puPAR-, puPA- or pU2-intraperitoneally injected mice. To determine if interferon induction was present intracranially, total RNA was isolated from fresh or paraffin-embedded brain tissue from mice injected with control, EV/SV, puPAR, puPA, pU2, or interferon (0.5ng) intracranially and RT-PCR was performed using primers specific for OAS1 (Fig. 5E). Nude mice were implanted with intracranial xenograft tumors and their survival ability was determined. Two sets of animals were used (6 mice/group). Both sets of mice were implanted with intracranial xenograft tumors as described previously. Ten days after tumor implantation, the mice were treated with intraperitoneal injections of pU2 plasmid (150μg/injection/mouse) three times every other day. Control mice were either injected with PBS alone or with empty plasmid vector (150μg/injection/mouse). The mice were maintained in clean room conditions and monitored every day for 112 days after which the experiment was artificially terminated. Brains were harvested, paraffin embedded, sectioned, and Hɮ stained as per standard protocols. Survival curve was plotted per standard methods and graphically represented (Fig 5F).


Conclusion

The use of botulinum toxins has revolutionised the treatment of various ophthalmic spastic disorders, facial dystonias and periocular wrinkles. A precise knowledge and understanding of the functional anatomy of the mimetic muscles is absolutely necessary to correctly use botulinum toxins in clinical practice. Adverse effects are usually mild and transient. The most common substantive complication is excessive or unwanted weakness, and this resolves as the action of the toxin is lost. Brow ptosis, eyelid ptosis, neck weakness, dysphagia, and diplopia may occur. Knowledge of the functional anatomy and experience with the procedure help injectors avoid complications. In future, the development of new potent toxins with increasing effectiveness and duration of effect will further aid this expanding and interesting field of chemodenervation.


Zebrafish at the Interface of Development and Disease Research

Victoria E. Prince , . Gokhan Dalgin , in Current Topics in Developmental Biology , 2017

4.1.2 Chemical Destruction of Beta Cells

Streptozotocin (STZ) is a common reagent used to injure the pancreas in rodents. STZ is also effective at beta cell ablation in adult fish, but relatively high concentrations are needed both in zebrafish ( Moss et al., 2009 Olsen, Sarras, & Intine, 2010 Sarras, Leontovich, Olsen, & Intine, 2013 ) and in another teleost fish model, Tilapia ( Wright, Abraham, Dickson, Yang, & Morrison, 1999 ). Use of STZ in zebrafish embryos or larvae has not been reported, nor was this approach effective in our hands (RMA, unpublished). Interestingly, human beta cells are very resistant to STZ ( Yang & Wright, 2002 ), suggesting that fish beta cells may be more similar to human beta cells than to those of mice in this regard.


Jie Z, Xia H, Zhong SL, Feng Q, Li S, Liang S, Zhong H, Liu Z, Gao Y, Zhao H, et al. The gut microbiome in atherosclerotic cardiovascular disease. Nat Commun. 20178:845.

Zhao L, Zhang F, Ding X, Wu G, Lam YY, Wang X, Fu H, Xue X, Lu C, Ma J, et al. Gut bacteria selectively promoted by dietary fibers alleviate type 2 diabetes. Science. 2018359:1151–6.

Cho I, Blaser MJ. The human microbiome: at the interface of health and disease. Nat Rev Genet. 201213:260–70.

McKenney PT, Pamer EG. From hype to hope: the gut microbiota in enteric infectious disease. Cellule. 2015163:1326–32.

Brown RL, Sequeira RP, Clarke TB. The microbiota protects against respiratory infection via GM-CSF signaling. Nat Commun. 20178:1512.

Boktor SW, Hafner JW. Grippe. In: StatPearls. Treasure Island (FL): StatPearls Publishing 2020.

Davidson S. Treating influenza infection, from now and into the future. Immunol avant. 20189:1946.

Shi J, Deng G, Ma S, Zeng X, Yin X, Li M, Zhang B, Cui P, Chen Y, Yang H, et al. Rapid evolution of H7N9 highly pathogenic viruses that emerged in China in 2017. Cell Host Microbe. 201824(4):558–568.e7.

Ichinohe T, Pang IK, Kumamoto Y, Peaper DR, Ho JH, Murray TS, Iwasaki A. Microbiota regulates immune defense against respiratory tract influenza A virus infection. Proc Natl Acad Sci U S A. 2011108:5354–9.

Steed AL, Christophi GP, Kaiko GE, Sun L, Goodwin VM, Jain U, Esaulova E, Artyomov MN, Morales DJ, Holtzman MJ, et al. The microbial metabolite desaminotyrosine protects from influenza through type I interferon. Science. 2017357:498–502.

Rosshart SP, Vassallo BG, Angeletti D, Hutchinson DS, Morgan AP, Takeda K, Hickman HD, McCulloch JA, Badger JH, Ajami NJ, et al. Wild mouse gut microbiota promotes host fitness and improves disease resistance. Cellule. 2017171:1015–28 e1013.

Masetti G, Moshkelgosha S, Kohling HL, Covelli D, Banga JP, Berchner-Pfannschmidt U, Horstmann M, Diaz-Cano S, Goertz GE, Plummer S, et al. Gut microbiota in experimental murine model of Graves’ orbitopathy established in different environments may modulate clinical presentation of disease. Microbiome. 20186:97.

Flemer B, Warren RD, Barrett MP, Cisek K, Das A, Jeffery IB, Hurley E, O’Riordain M, Shanahan F, O’Toole PW. The oral microbiota in colorectal cancer is distinctive and predictive. Intestin. 201867:1454–63.

Brown RL, Clarke TB. The regulation of host defences to infection by the microbiota. Immunology. 2017150:1–6.

Sanchez KK, Chen GY, Schieber AMP, Redford SE, Shokhirev MN, Leblanc M, Lee YM, Ayres JS. Cooperative metabolic adaptations in the host can favor asymptomatic infection and select for attenuated virulence in an enteric pathogen. Cellule. 2018175:146–58 e115.

Le Barz M, Daniel N, Varin TV, Naimi S, Demers-Mathieu V, Pilon G, Audy J, Laurin E, Roy D, Urdaci MC, et al. In vivo screening of multiple bacterial strains identifies Lactobacillus rhamnosus Lb102 and Bifidobacterium animalis ssp. lactis Bf141 as probiotics that improve metabolic disorders in a mouse model of obesity. FASEB J. 201933(4):4921–4935.

Fang HR, Zhang GQ, Cheng JY, Li ZY. Efficacy of Lactobacillus-supplemented triple therapy for Helicobacter pylori infection in children: a meta-analysis of randomized controlled trials. Eur J Pédiatr. 2019178:7–16.

Routy B, Le Chatelier E, Derosa L, Duong CPM, Alou MT, Daillere R, Fluckiger A, Messaoudene M, Rauber C, Roberti MP, et al. Gut microbiome influences efficacy of PD-1-based immunotherapy against epithelial tumors. Science. 2018359:91–7.

Yildiz S, Mazel-Sanchez B, Kandasamy M, Manicassamy B, Schmolke M. Influenza A virus infection impacts systemic microbiota dynamics and causes quantitative enteric dysbiosis. Microbiome. 20186:9.

Kawahara T, Takahashi T, Oishi K, Tanaka H, Masuda M, Takahashi S, Takano M, Kawakami T, Fukushima K, Kanazawa H, Suzuki T. Consecutive oral administration of Bifidobacterium longum MM-2 improves the defense system against influenza virus infection by enhancing natural killer cell activity in a murine model. Microbiol Immunol. 201559:1–12.

Hori T, Kiyoshima J, Shida K, Yasui H. Augmentation of cellular immunity and reduction of influenza virus titer in aged mice fed Lactobacillus casei strain Shirota. Clin Diagn Lab Immunol. 20029:105–8.

Villena J, Chiba E, Tomosada Y, Salva S, Marranzino G, Kitazawa H, Alvarez S. Orally administered Lactobacillus rhamnosus modulates the respiratory immune response triggered by the viral pathogen-associated molecular pattern poly(I:C). BMC Immunol. 201213:53.

Kiso M, Takano R, Sakabe S, Katsura H, Shinya K, Uraki R, Watanabe S, Saito H, Toba M, Kohda N, Kawaoka Y. Protective efficacy of orally administered, heat-killed Lactobacillus pentosus b240 against influenza a virus. Sci Rep. 20133:1563.

Cook JC, Wu H, Aleo MD, Adkins K. Principles of precision medicine and its application in toxicology. J Toxicol Sci. 201843:565–77.

Giovannoni G. Personalized medicine in multiple sclerosis. Neurodegener Dis Manag. 20177:13–7.

Valenzuela-Sanchez F, Valenzuela-Mendez B, Rodriguez-Gutierrez JF, Rello J. Personalized medicine in severe influenza. Eur J Clin Microbiol Infect Dis. 201635:893–7.

Ruiz L, Delgado S, Ruas-Madiedo P, Margolles A, Sanchez B. Proteinaceous molecules mediating Bifidobacterium-host interactions. Microbiol avant. 20167:1193.

Azzam MM, Dong XY, Dai L, Zou XT. Effect of excess dietary L-valine on laying hen performance, egg quality, serum free amino acids, immune function and antioxidant enzyme activity. Br Poult Sci. 201556:72–8.

Luo JB, Feng L, Jiang WD, Liu Y, Wu P, Jiang J, Kuang SY, Tang L, Zhang YA, Zhou XQ. The impaired intestinal mucosal immune system by valine deficiency for young grass carp (Ctenopharyngodon idella) is associated with decreasing immune status and regulating tight junction proteins transcript abundance in the intestine. Fish Shellfish Immunol. 201440:197–207.

Shurubor YI, D’Aurelio M, Clark-Matott J, Isakova EP, Deryabina YI, Beal MF, Cooper AJL, Krasnikov BF. Determination of coenzyme a and acetyl-coenzyme A in biological samples using HPLC with UV detection. Molecules. 201722(9):1388.

Zhang Z, Lv J, Pan L, Zhang Y. Roles and applications of probiotic Lactobacillus strains. Appl Microbiol Biotechnol. 2018102:8135–43.

Derrien M, Van Baarlen P, Hooiveld G, Norin E, Muller M, de Vos WM. Modulation of mucosal immune response, tolerance, and proliferation in mice colonized by the Mucin-degrader Akkermansia muciniphila. Microbiol avant. 20112:166.

Cani PD, de Vos WM. Next-generation beneficial microbes: the case of Akkermansia muciniphila. Microbiol avant. 20178:1765.

Nishiyama K, Yamamoto Y, Sugiyama M, Takaki T, Urashima T, Fukiya S, Yokota A, Okada N, Mukai T. Bifidobacterium bifidum extracellular sialidase enhances adhesion to the mucosal surface and supports carbohydrate assimilation. mBio. 20178(5):e00928–17.

Zhao Z, Yi C, Zhao L, Wang S, Zhou L, Hu Y, Zou W, Chen H, Jin M. PB2-588I enhances 2009 H1N1 pandemic influenza virus virulence by increasing viral replication and exacerbating PB2 inhibition of beta interferon expression. J Virol. 201488:2260–7.

Staley C, Kaiser T, Beura LK, Hamilton MJ, Weingarden AR, Bobr A, Kang J, Masopust D, Sadowsky MJ, Khoruts A. Stable engraftment of human microbiota into mice with a single oral gavage following antibiotic conditioning. Microbiome. 20175:87.

Hu J, Ma L, Nie Y, Chen J, Zheng W, Wang X, Xie C, Zheng Z, Wang Z, Yang T, et al. A microbiota-derived bacteriocin targets the host to confer diarrhea resistance in early-weaned piglets. Cell Host Microbe. 201824:817–32 e818.

Jacquet N, Navarre C, Desmecht D, Boutry M. Hydrophobin fusion of an influenza virus hemagglutinin allows high transient expression in Nicotiana benthamiana, easy purification and immune response with neutralizing activity. PLoS One. 20149:e115944.

Reed ML, Bridges OA, Seiler P, Kim JK, Yen HL, Salomon R, Govorkova EA, Webster RG, Russell CJ. The pH of activation of the hemagglutinin protein regulates H5N1 influenza virus pathogenicity and transmissibility in ducks. J Virol. 201084:1527–35.

Sonnenburg ED, Smits SA, Tikhonov M, Higginbottom SK, Wingreen NS, Sonnenburg JL. Diet-induced extinctions in the gut microbiota compound over generations. La nature. 2016529:212–5.

Magoc T, Salzberg SL. FLASH: fast length adjustment of short reads to improve genome assemblies. Bioinformatique. 201127:2957–63.

Caporaso JG, Kuczynski J, Stombaugh J, Bittinger K, Bushman FD, Costello EK, Fierer N, Pena AG, Goodrich JK, Gordon JI, et al. QIIME allows analysis of high-throughput community sequencing data. Méthodes Nat. 20107:335–6.

Edgar RC. UPARSE: highly accurate OTU sequences from microbial amplicon reads. Méthodes Nat. 201310:996–8.

Quast C, Pruesse E, Yilmaz P, Gerken J, Schweer T, Yarza P, Peplies J, Glockner FO. The SILVA ribosomal RNA gene database project: improved data processing and web-based tools. Acides nucléiques Res. 201341:D590–6.

Langmead B, Salzberg SL. Fast gapped-read alignment with Bowtie 2. Nat Methods. 20129:357–9.

Li R, Yu C, Li Y, Lam TW, Yiu SM, Kristiansen K, Wang J. SOAP2: an improved ultrafast tool for short read alignment. Bioinformatique. 200925:1966–7.

Zhu W, Lomsadze A, Borodovsky M. Ab initio gene identification in metagenomic sequences. Acides nucléiques Res. 201038:e132.

Li W, Godzik A. Cd-hit: a fast program for clustering and comparing large sets of protein or nucleotide sequences. Bioinformatique. 200622:1658–9.

Qin J, Li R, Raes J, Arumugam M, Burgdorf KS, Manichanh C, Nielsen T, Pons N, Levenez F, Yamada T, et al. A human gut microbial gene catalogue established by metagenomic sequencing. La nature. 2010464:59–65.

Villar E, Farrant GK, Follows M, Garczarek L, Speich S, Audic S, Bittner L, Blanke B, Brum JR, Brunet C, et al. Ocean plankton. Environmental characteristics of Agulhas rings affect interocean plankton transport. Science. 2015348:1261447.

Buchfink B, Xie C, Huson DH. Fast and sensitive protein alignment using DIAMOND. Méthodes Nat. 201512:59–60.

Huson DH, Auch AF, Qi J, Schuster SC. MEGAN analysis of metagenomic data. Génome Res. 200717:377–86.

Backhed F, Roswall J, Peng Y, Feng Q, Jia H, Kovatcheva-Datchary P, Li Y, Xia Y, Xie H, Zhong H, et al. Dynamics and stabilization of the human gut microbiome during the first year of life. Cell Host Microbe. 201517:852.

Greenblum S, Turnbaugh PJ, Borenstein E. Metagenomic systems biology of the human gut microbiome reveals topological shifts associated with obesity and inflammatory bowel disease. Proc Natl Acad Sci U S A. 2012109:594–9.

Nielsen HB, Almeida M, Juncker AS, Rasmussen S, Li J, Sunagawa S, Plichta DR, Gautier L, Pedersen AG, Le Chatelier E, et al. Identification and assembly of genomes and genetic elements in complex metagenomic samples without using reference genomes. Nat Biotechnol. 201432:822–8.

Qin J, Li Y, Cai Z, Li S, Zhu J, Zhang F, Liang S, Zhang W, Guan Y, Shen D, et al. A metagenome-wide association study of gut microbiota in type 2 diabetes. La nature. 2012490:55–60.

Seishima J, Iida N, Kitamura K, Yutani M, Wang Z, Seki A, Yamashita T, Sakai Y, Honda M, Yamashita T, et al. Gut-derived Enterococcus faecium from ulcerative colitis patients promotes colitis in a genetically susceptible mouse host. Génome Biol. 201920:252.

Junick J, Blaut M. Quantification of human fecal Bifidobacterium species by use of quantitative real-time PCR analysis targeting the groEL gene. Appl Environ Microbiol. 201278:2613–22.

Segata N, Izard J, Waldron L, Gevers D, Miropolsky L, Garrett WS, Huttenhower C. Metagenomic biomarker discovery and explanation. Génome Biol. 201112:R60.

White JR, Nagarajan N, Pop M. Statistical methods for detecting differentially abundant features in clinical metagenomic samples. PLoS Comput Biol. 20095:e1000352.

Zhang Q, Hu J, Feng J-W, Hu X-T, Wang T, Gong W-X, Huang K, Guo Y-X, Zou Z, et al: Study on the diversity of gut microorganisms in mice infected with different toxic H7N9 viruses. EBI European Nucleotide Archive. Project PRJEB31298. https://www.ebi.ac.uk/ena/data/view/PRJEB31298. Accessed 31 May 2019.


Intraperitoneal oil application causes local inflammation with depletion of resident peritoneal macrophages

Oils, used as solvents for many drugs and compounds, may cause inflammation if injected intraperitoneally.

Fond:
Mice are treated with drugs and compounds for various purposes such as conditional alteration of a gene, depletion of cells, or recapitulating human diseases and finding their cure (Günschmann et al., 2014 Hua, Shi, Shultz, & Ren, 2018 Rosenthal & Brown, 2007). These compounds are dissolved in the respective solvents depending on their hydrophilicity and are administered via different routes such as oral gavage, intraperitoneal injection (I.P.), intravenous injection and subcutaneous injection, to maximize the effects of the treatments (Turner, Brabb, Pekow, & Vasbinder, 2011). Usually, mice treated with oil are used as controls along with the wild type mice to rule out any effects of the oil or the route of administration. This makes it essential to ensure that the mice treated with oil and the untreated wild type mice are comparable so that any significant change following treatment is attributed only to the experimental compound. It also helps in reducing the chances of side-effects, thereby improving the specificity and authenticity of the experimental system.
Alsina-Sanchis et al. study the potential of vegetal and mineral oils to induce inflammation in the peritoneum and suggest that oral gavage instead of intraperitoneal injection might be a safer way to deliver lipophilic compounds to avoid inflammation.

Principales conclusions:
1.) Significant increase in inflammation in the omentum and the mesentery upon intraperitoneal injection of peanut and mineral oils
The authors show that the omentum of the mice treated with oil by I.P. is swollen and dark with larger blood vessels. The vessel density also increases as shown by the quantification of CD31 staining, (a marker for endothelial cells). While all the oils show inflammatory response by increased recruitment of CD11b+ cells or by the presence of foamy macrophages, the effects are most pronounced for peanut and mineral oils. Furthermore, Sirius red staining shows an increased deposition of collagen that indicates fibrosis. They observe similar changes in the mesentery too, implicating chances of peritoneal inflammation by oil injected in the peritoneum. Mice treated by oral gavage are comparable with the untreated mice with no inflammatory burden.

2.) Oils deplete tissue-resident macrophage population by causing their death
The total population of macrophages (CD45+CD11+F4/80+) does not change between untreated or oil-injected mice. But staining for Tim4, a marker for long term resident macrophages, shows a significant reduction in their number, thereby, suggesting an increased recruitment of monocyte-derived macrophages associated with depletion of the resident population.
Macrophages take up oils and perish by different mechanisms such as apoptosis, necrosis, efferocytosis and pyroptosis. The mode of death determines whether the inflammation would be resolved. The authors study the mechanisms of death in macrophages by flow cytometric analysis on the peritoneal macrophages and by staining of cell lines treated with oils. They show that taking up olive oil by macrophages leads to their death by apoptosis which aids in resolving inflammation. However, peanut oil causes pyroptosis in macrophages impeding the reduction in inflammation.

3.) Thioglycolate-induced peritonitis model and mice intraperitoneally injected with oil have comparable inflammatory burden
When bacterial peritonitis is induced in mice by treating them with thioglycolate, the authors observe that the mice receiving peanut oil by oral gavage register a 50% increase in the myeloid cell population. But when treated with peanut oil by I.P., mice do not show a significant change in the number of myeloid cells as they already exhibit a basal level of inflammation.
Taken together, the authors suggest that oral gavage is a better and safer way to administer lipophilic compounds than I.P.

What intrigued me to choose this preprint?
The authors have tried to shed light on the choice of solvents and their correct route of administration to avoid inflammation. This work may serve as a guide for those who want to treat mice for experimental purposes.

Open questions:
1.) In this work, I.P. is given for 5 consecutive days whereas oral gavage is done once. Does this treatment regime itself introduce the differential inflammation burden?
2.) Not all I.P. treatments need to be done for 5 consecutive days. I.P. can also be given once to achieve desirable effects in a context-dependent manner. In that case, how will the inflammation status be affected?
3.) I.P. results in global effects. In that case should one expect a global change in systemic inflammation?
4.) While the mechanisms underlying the death of macrophages are shown to be independent of inflammation what properties of these oils might have led to the differential effects?

Les références:
Günschmann, C., Chiticariu, E., Garg, B., Hiz, M. M., Mostmans, Y., Wehner, M., & Scharfenberger, L. (2014). Transgenic mouse technology in skin biology: Inducible gene knockout in mice. Journal of Investigative Dermatology. https://doi.org/10.1038/jid.2014.213
Hua, L., Shi, J., Shultz, L. D., & Ren, G. (2018). Genetic models of macrophage depletion. Dans
Methods in Molecular Biology. https://doi.org/10.1007/978-1-4939-7837-3_22
Rosenthal, N., & Brown, S. (2007). The mouse ascending: Perspectives for human-disease models. Nature Cell Biology. https://doi.org/10.1038/ncb437
Turner, P. V., Brabb, T., Pekow, C., & Vasbinder, M. A. (2011). Administration of substances to laboratory animals: Routes of administration and factors to consider. Journal of the American Association for Laboratory Animal Science.

Posted on: 12th September 2020 , updated on: 21st September 2020

Partagez ceci :

Read preprint (No Ratings Yet)

Discussion

In the present study, we provide evidence to suggest that the direct i.p. injections of plasmids expressing siRNA targeting uPAR and uPA inhibit intracranial tumor growth in nude mice. Extracellular matrix destruction is dependent on the expression of proteases, which are overexpressed in gliomas (34–37). Using an adenovirus-mediated antisense construct for uPAR and uPA, we have already shown that the simultaneous down-regulation of uPAR and uPA has a synergistic effect rather than an additive one (38). However, using an adenovirus to deliver therapeutic genes presents significant problems, including accurate targeting and toxicity (39). In recent years, several groups have experimented with various modifications, but thus far, none of these altered methods have been successful in eliminating the aforementioned problems (40). Here, we show that a simple CMV plasmid vector driving the production of hairpin-like RNA molecules can be used therapeutically. As indicated by the RT-PCR results, the use of an mRNA-like molecule possessing a polyadenylic acid tail and having 21-bp inverted repeats, which target uPAR and uPA, did not induce an IFN-like response. Other groups have used lentiviral vectors to successfully target specific proteases, such as plasminogen activator inhibitor-1, but still induced OAS1 (41). Here, we did not observe the induction of OAS1. This might have been due to the presence of a polyadenylic acid tail mimicking cellular mRNA and appearing as “self” to the cell. As expected, the down-regulation of the target mRNA molecule was observed with siRNA, whereas no down-regulation was observed with the use of an antisense sequence. With an antisense approach, equimolar quantities of the antisense molecule are required to silence the target gene. This is not required with RNAi where the RISC behaves like a catalyst and is reused (42). In essence, a small amount of RNAi-inducing molecules, such as siRNA or hpRNA, is sufficient to induce silencing of target genes. Our results show that future therapeutic use of RNAi to treat gliomas is very probable. Urokinase plasminogen activator and its receptor play important roles in invasion and migration of metastatic gliomas (35–37). Using these proteases as targets is very attractive for the treatment of gliomas.

In terms of angiogenesis, the use of antiangiogenic drugs has been met with mixed success (43). The targeting of uPAR and uPA, which are also indirectly involved in angiogenic pathways (44, 45), has revealed the importance of their targeting in cancer therapy. Our results show that the simultaneous down-regulation of uPAR and uPA causes the down-regulation of EGFR and VEGF in EGFR-overexpressing glioma xenograft cells (4910). In situ studies confirm Western blot analysis results in also demonstrating the down-regulation of EGFR and VEGF. In situ angiogenic assays have shown that endothelial cells cocultured with EGFR-overexpressing 4910 cells induce the endothelial cells to form a network-like pattern mimicking tumor angiogenesis. Progressive reduction in the network formation was seen in puPAR- and puPA-transfected cells. In cells transfected with pU2, we observed complete regression of network formation, indicating that the simultaneous down-regulation of uPAR and uPA causes the tumor cells to retard or stop secreting factors necessary for the induction of angiogenesis. The dorsal skin fold assay, an in vivo angiogenic assay, revealed complete inhibition of angiogenesis by pU2-transfected 4910 cells. Although our previous work using an adenovirus-mediated strategy had similar results (38), the major difference is that 100 multiplicity of infection of virus particles were required to achieve the same effect as 6 μg of plasmid. We also observed similar results with the other assays. For example, spheroid migration was significantly inhibited in pU2-treated SNB19 and 4910 xenograft cells. Our invasion studies showed that after transfection with pU2, both SNB19 and 4910 cells exhibited a significant reduction in their invasive ability—only 5% to 8% invasion when compared with the controls. From these spheroid invasion assay results, it is clear that the simultaneous down-regulation of uPAR and uPA retards the invasion of fetal rat brain aggregates.

uPAR is associated with integrins and is known to mediate cellular motility via extracellular matrix components such as vitronectin (46). In addition, association of uPAR with integrins mediates ras signaling pathways (47, 48). uPAR and uPA have also been observed at the leading edge of invading tumors (48). Hence, uPAR is a logical target to inhibit tumor invasion and migration. Our animal studies show that the simultaneous down-regulation of uPAR and uPA causes the regression of intracranial tumors. Nude mice implanted with 4910 xenograft cells intracranially usually die in 4 weeks due to tumor invasion. In contrast, mice injected with pU2 i.p. do not exhibit tumor establishment and survived for over 112 days after implantation. It would be of academic interest to see if similar results can be obtained using antisense vector constructs. Nevertheless, as the in situ hybridization studies indicated, there was translocation of the i.p. injected plasmid to the brain. The plasmids may pass through the blood-brain barrier probably due to the already compromised blood-brain barrier at the tumor site. The presence of the plasmid intracranially in control was seen primarily surrounding vessels (not shown). As such, the potential for using siRNA vectors for future therapy is promising. Agrawal and Iyer (49) have reviewed the advantages and disadvantages of using an antisense strategy for therapeutic purposes. Our results show that, in spite of being injected i.p., siRNA-expressing plasmids localize intracranially and effectively down-regulate uPAR and uPA. RT-PCR of the brain tissue showed that although plasmid localization was observed in the brain, no OAS1 induction was detected. This indicates that the presence of a polyadenylic acid tail probably prevented the induction of an IFN-like response. In conclusion, the RNAi-mediated down-regulation of uPAR and uPA has clear clinical implications for the treatment of gliomas as well as other cancers.


Voir la vidéo: Quest ce quune injection intramusculaire? (Janvier 2022).